423
submitted 1 year ago by lelgenio@lemmy.ml to c/memes@lemmy.ml

An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"

you are viewing a single comment's thread
view the rest of the comments

The future of onlyfans products

this post was submitted on 23 Jul 2023
423 points (94.3% liked)

Memes

45656 readers
679 users here now

Rules:

  1. Be civil and nice.
  2. Try not to excessively repost, as a rule of thumb, wait at least 2 months to do it if you have to.

founded 5 years ago
MODERATORS