423
submitted 1 year ago by lelgenio@lemmy.ml to c/memes@lemmy.ml

An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"

you are viewing a single comment's thread
view the rest of the comments
[-] 30isthenew29@lemm.ee 6 points 1 year ago

I wonder if theoretically you could share humans through the internet? Share your sequence and someone can download it and build it with a theoretical machine. Would probably be a few Petabytes of data though like you can see in that Black Mirror episode with that spaceship.

The future of onlyfans products

load more comments (5 replies)
this post was submitted on 23 Jul 2023
423 points (94.3% liked)

Memes

45656 readers
679 users here now

Rules:

  1. Be civil and nice.
  2. Try not to excessively repost, as a rule of thumb, wait at least 2 months to do it if you have to.

founded 5 years ago
MODERATORS