this post was submitted on 23 Jul 2023
422 points (94.3% liked)

Memes

51610 readers
1942 users here now

Rules:

  1. Be civil and nice.
  2. Try not to excessively repost, as a rule of thumb, wait at least 2 months to do it if you have to.

founded 6 years ago
MODERATORS
 

An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"

you are viewing a single comment's thread
view the rest of the comments
[–] Kowowow@lemmy.ca 4 points 2 years ago

ya I've kind of been wondering if with how foods and random mutations affect dna I doubt you could use baby you dna to get an adult that actually looks exactly like you