423
submitted 1 year ago by lelgenio@lemmy.ml to c/memes@lemmy.ml

An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"

you are viewing a single comment's thread
view the rest of the comments
[-] TauZero@mander.xyz 3 points 1 year ago

Out of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?

[-] Glifted@lemmy.world 10 points 1 year ago

If "reading" the sequence, it sounds similar to Mr Krab's laugh

[-] apotheotic@beehaw.org 7 points 1 year ago

Mr Krabs laughs very distinctly, and it sort of sounds like it would be spelt like the genome in the OP. Check it out on yt or something, should help

this post was submitted on 23 Jul 2023
423 points (94.3% liked)

Memes

45656 readers
720 users here now

Rules:

  1. Be civil and nice.
  2. Try not to excessively repost, as a rule of thumb, wait at least 2 months to do it if you have to.

founded 5 years ago
MODERATORS