An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"
this post was submitted on 23 Jul 2023
422 points (94.3% liked)
Memes
51752 readers
1480 users here now
Rules:
- Be civil and nice.
- Try not to excessively repost, as a rule of thumb, wait at least 2 months to do it if you have to.
founded 6 years ago
MODERATORS
you are viewing a single comment's thread
view the rest of the comments
view the rest of the comments
Out of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?
If "reading" the sequence, it sounds similar to Mr Krab's laugh
Mr Krabs laughs very distinctly, and it sort of sounds like it would be spelt like the genome in the OP. Check it out on yt or something, should help