423
submitted 1 year ago by lelgenio@lemmy.ml to c/memes@lemmy.ml

An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"

top 12 comments
sorted by: hot top controversial new old
[-] Gruxx@kbin.social 19 points 1 year ago

Ugh it didn't blast or translate

EMBOSS_001_1
NVIALPVGTX
EMBOSS_001_2
TS
PDYQVLX
EMBOSS_001_3
RHSLITSRY

EMBOSS_001_4
STYW*SGYDV
EMBOSS_001_5
YLLVIRLRX
EMBOSS_001_6
LVPTGNQAMTX

[-] TauZero@mander.xyz 3 points 1 year ago

Out of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?

[-] Glifted@lemmy.world 10 points 1 year ago

If "reading" the sequence, it sounds similar to Mr Krab's laugh

[-] apotheotic@beehaw.org 7 points 1 year ago

Mr Krabs laughs very distinctly, and it sort of sounds like it would be spelt like the genome in the OP. Check it out on yt or something, should help

[-] rusticus1773@lemmy.ml 6 points 1 year ago

Only 3 billion short

[-] 30isthenew29@lemm.ee 6 points 1 year ago

I wonder if theoretically you could share humans through the internet? Share your sequence and someone can download it and build it with a theoretical machine. Would probably be a few Petabytes of data though like you can see in that Black Mirror episode with that spaceship.

[-] Mininux@sh.itjust.works 10 points 1 year ago

If we ignore the mutations in the life of an individual, it would actually only be a few hundreds megabytes. Or if we already have a template of a human genome and we only code the difference between them and the human we want to copy, a few megabytes is enough since we all share A LOT of sequences

Wikipedia: Human genome#Information content

[-] Kowowow@lemmy.ca 4 points 1 year ago

ya I've kind of been wondering if with how foods and random mutations affect dna I doubt you could use baby you dna to get an adult that actually looks exactly like you

[-] capy_bara@lemmy.world 2 points 1 year ago

There is also epigenetic modifications to be considered

[-] Mininux@sh.itjust.works 1 points 1 year ago

Oh cool I didn't know that stuff, it's super interesting

[-] 30isthenew29@lemm.ee 0 points 1 year ago

It bottles the mind.

The future of onlyfans products

this post was submitted on 23 Jul 2023
423 points (94.3% liked)

Memes

45656 readers
720 users here now

Rules:

  1. Be civil and nice.
  2. Try not to excessively repost, as a rule of thumb, wait at least 2 months to do it if you have to.

founded 5 years ago
MODERATORS